ID: 1048573722

View in Genome Browser
Species Human (GRCh38)
Location 8:135675220-135675242
Sequence CTGTTATCTTGGATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048573719_1048573722 19 Left 1048573719 8:135675178-135675200 CCATTTTGATCACTCAACTGACT No data
Right 1048573722 8:135675220-135675242 CTGTTATCTTGGATGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048573722 Original CRISPR CTGTTATCTTGGATGGAGCA AGG Intergenic
No off target data available for this crispr