ID: 1048574129

View in Genome Browser
Species Human (GRCh38)
Location 8:135677748-135677770
Sequence CCATTAGGACATCATGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048574119_1048574129 24 Left 1048574119 8:135677701-135677723 CCCCTTAAAGCGATGCCAGCCAC No data
Right 1048574129 8:135677748-135677770 CCATTAGGACATCATGAAGATGG No data
1048574124_1048574129 5 Left 1048574124 8:135677720-135677742 CCACACAGCTGAAGGAAAAATAT No data
Right 1048574129 8:135677748-135677770 CCATTAGGACATCATGAAGATGG No data
1048574123_1048574129 9 Left 1048574123 8:135677716-135677738 CCAGCCACACAGCTGAAGGAAAA No data
Right 1048574129 8:135677748-135677770 CCATTAGGACATCATGAAGATGG No data
1048574118_1048574129 30 Left 1048574118 8:135677695-135677717 CCTTCTCCCCTTAAAGCGATGCC No data
Right 1048574129 8:135677748-135677770 CCATTAGGACATCATGAAGATGG No data
1048574121_1048574129 22 Left 1048574121 8:135677703-135677725 CCTTAAAGCGATGCCAGCCACAC No data
Right 1048574129 8:135677748-135677770 CCATTAGGACATCATGAAGATGG No data
1048574120_1048574129 23 Left 1048574120 8:135677702-135677724 CCCTTAAAGCGATGCCAGCCACA No data
Right 1048574129 8:135677748-135677770 CCATTAGGACATCATGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048574129 Original CRISPR CCATTAGGACATCATGAAGA TGG Intergenic
No off target data available for this crispr