ID: 1048579562

View in Genome Browser
Species Human (GRCh38)
Location 8:135719838-135719860
Sequence ATGTGGCAGCTGCATGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048579562_1048579568 25 Left 1048579562 8:135719838-135719860 CCAGCTTCATGCAGCTGCCACAT No data
Right 1048579568 8:135719886-135719908 CTCAGACCCTCCTGTGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048579562 Original CRISPR ATGTGGCAGCTGCATGAAGC TGG (reversed) Intergenic
No off target data available for this crispr