ID: 1048580116

View in Genome Browser
Species Human (GRCh38)
Location 8:135723707-135723729
Sequence CTTTCATTTCTCACCTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048580116_1048580119 -4 Left 1048580116 8:135723707-135723729 CCCACACAGGTGAGAAATGAAAG No data
Right 1048580119 8:135723726-135723748 AAAGAAAAAGCTCTTCCTGGTGG No data
1048580116_1048580118 -7 Left 1048580116 8:135723707-135723729 CCCACACAGGTGAGAAATGAAAG No data
Right 1048580118 8:135723723-135723745 ATGAAAGAAAAAGCTCTTCCTGG No data
1048580116_1048580121 17 Left 1048580116 8:135723707-135723729 CCCACACAGGTGAGAAATGAAAG No data
Right 1048580121 8:135723747-135723769 GGTCATCTGATCTTTCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048580116 Original CRISPR CTTTCATTTCTCACCTGTGT GGG (reversed) Intergenic