ID: 1048580121

View in Genome Browser
Species Human (GRCh38)
Location 8:135723747-135723769
Sequence GGTCATCTGATCTTTCCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048580117_1048580121 16 Left 1048580117 8:135723708-135723730 CCACACAGGTGAGAAATGAAAGA No data
Right 1048580121 8:135723747-135723769 GGTCATCTGATCTTTCCTAATGG No data
1048580116_1048580121 17 Left 1048580116 8:135723707-135723729 CCCACACAGGTGAGAAATGAAAG No data
Right 1048580121 8:135723747-135723769 GGTCATCTGATCTTTCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048580121 Original CRISPR GGTCATCTGATCTTTCCTAA TGG Intergenic
No off target data available for this crispr