ID: 1048581441

View in Genome Browser
Species Human (GRCh38)
Location 8:135732468-135732490
Sequence CGCCTCCAAAGGAGACCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048581441_1048581449 20 Left 1048581441 8:135732468-135732490 CCTCCCGGTCTCCTTTGGAGGCG No data
Right 1048581449 8:135732511-135732533 TTCACTGTTTTCTCTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048581441 Original CRISPR CGCCTCCAAAGGAGACCGGG AGG (reversed) Intergenic