ID: 1048590523

View in Genome Browser
Species Human (GRCh38)
Location 8:135816891-135816913
Sequence GGCCTAAATAGAACAAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048590512_1048590523 11 Left 1048590512 8:135816857-135816879 CCCCAGTGTGGGCGGGCACCACC No data
Right 1048590523 8:135816891-135816913 GGCCTAAATAGAACAAAAGGAGG No data
1048590513_1048590523 10 Left 1048590513 8:135816858-135816880 CCCAGTGTGGGCGGGCACCACCC No data
Right 1048590523 8:135816891-135816913 GGCCTAAATAGAACAAAAGGAGG No data
1048590519_1048590523 -10 Left 1048590519 8:135816878-135816900 CCCAATCCACTGGGGCCTAAATA No data
Right 1048590523 8:135816891-135816913 GGCCTAAATAGAACAAAAGGAGG No data
1048590518_1048590523 -7 Left 1048590518 8:135816875-135816897 CCACCCAATCCACTGGGGCCTAA No data
Right 1048590523 8:135816891-135816913 GGCCTAAATAGAACAAAAGGAGG No data
1048590511_1048590523 14 Left 1048590511 8:135816854-135816876 CCTCCCCAGTGTGGGCGGGCACC No data
Right 1048590523 8:135816891-135816913 GGCCTAAATAGAACAAAAGGAGG No data
1048590514_1048590523 9 Left 1048590514 8:135816859-135816881 CCAGTGTGGGCGGGCACCACCCA No data
Right 1048590523 8:135816891-135816913 GGCCTAAATAGAACAAAAGGAGG No data
1048590510_1048590523 15 Left 1048590510 8:135816853-135816875 CCCTCCCCAGTGTGGGCGGGCAC No data
Right 1048590523 8:135816891-135816913 GGCCTAAATAGAACAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048590523 Original CRISPR GGCCTAAATAGAACAAAAGG AGG Intergenic
No off target data available for this crispr