ID: 1048592209

View in Genome Browser
Species Human (GRCh38)
Location 8:135831281-135831303
Sequence GGATGCATCAATTTTCAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048592209_1048592210 -6 Left 1048592209 8:135831281-135831303 CCTTACTGAAAATTGATGCATCC No data
Right 1048592210 8:135831298-135831320 GCATCCTATAATATACTTTTTGG No data
1048592209_1048592212 0 Left 1048592209 8:135831281-135831303 CCTTACTGAAAATTGATGCATCC No data
Right 1048592212 8:135831304-135831326 TATAATATACTTTTTGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048592209 Original CRISPR GGATGCATCAATTTTCAGTA AGG (reversed) Intergenic
No off target data available for this crispr