ID: 1048592838

View in Genome Browser
Species Human (GRCh38)
Location 8:135837493-135837515
Sequence TGGGCTGAAAATGCATCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048592838_1048592844 9 Left 1048592838 8:135837493-135837515 CCTGAAGATGCATTTTCAGCCCA No data
Right 1048592844 8:135837525-135837547 CTGAATGCAGTTTTGTGGATTGG No data
1048592838_1048592842 4 Left 1048592838 8:135837493-135837515 CCTGAAGATGCATTTTCAGCCCA No data
Right 1048592842 8:135837520-135837542 TCCAGCTGAATGCAGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048592838 Original CRISPR TGGGCTGAAAATGCATCTTC AGG (reversed) Intergenic
No off target data available for this crispr