ID: 1048593824 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:135845804-135845826 |
Sequence | CAGGGTTCATCTTTTTCAAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1048593824_1048593834 | 28 | Left | 1048593824 | 8:135845804-135845826 | CCACTTGAAAAAGATGAACCCTG | No data | ||
Right | 1048593834 | 8:135845855-135845877 | AGCATCTCTGCTAGCCTCATAGG | No data | ||||
1048593824_1048593828 | -8 | Left | 1048593824 | 8:135845804-135845826 | CCACTTGAAAAAGATGAACCCTG | No data | ||
Right | 1048593828 | 8:135845819-135845841 | GAACCCTGACTCCACAGGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1048593824 | Original CRISPR | CAGGGTTCATCTTTTTCAAG TGG (reversed) | Intergenic | ||