ID: 1048593824

View in Genome Browser
Species Human (GRCh38)
Location 8:135845804-135845826
Sequence CAGGGTTCATCTTTTTCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048593824_1048593834 28 Left 1048593824 8:135845804-135845826 CCACTTGAAAAAGATGAACCCTG No data
Right 1048593834 8:135845855-135845877 AGCATCTCTGCTAGCCTCATAGG No data
1048593824_1048593828 -8 Left 1048593824 8:135845804-135845826 CCACTTGAAAAAGATGAACCCTG No data
Right 1048593828 8:135845819-135845841 GAACCCTGACTCCACAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048593824 Original CRISPR CAGGGTTCATCTTTTTCAAG TGG (reversed) Intergenic