ID: 1048593830

View in Genome Browser
Species Human (GRCh38)
Location 8:135845823-135845845
Sequence AGGGCCACCCCTGTGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048593830_1048593834 9 Left 1048593830 8:135845823-135845845 CCTGACTCCACAGGGGTGGCCCT No data
Right 1048593834 8:135845855-135845877 AGCATCTCTGCTAGCCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048593830 Original CRISPR AGGGCCACCCCTGTGGAGTC AGG (reversed) Intergenic