ID: 1048593831

View in Genome Browser
Species Human (GRCh38)
Location 8:135845830-135845852
Sequence CAGTAACAGGGCCACCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048593831_1048593836 28 Left 1048593831 8:135845830-135845852 CCACAGGGGTGGCCCTGTTACTG No data
Right 1048593836 8:135845881-135845903 AAAGAACATCGATAATTAAGTGG No data
1048593831_1048593834 2 Left 1048593831 8:135845830-135845852 CCACAGGGGTGGCCCTGTTACTG No data
Right 1048593834 8:135845855-135845877 AGCATCTCTGCTAGCCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048593831 Original CRISPR CAGTAACAGGGCCACCCCTG TGG (reversed) Intergenic