ID: 1048593832

View in Genome Browser
Species Human (GRCh38)
Location 8:135845842-135845864
Sequence CAGAGATGCTCACAGTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048593832_1048593834 -10 Left 1048593832 8:135845842-135845864 CCCTGTTACTGTGAGCATCTCTG No data
Right 1048593834 8:135845855-135845877 AGCATCTCTGCTAGCCTCATAGG No data
1048593832_1048593838 24 Left 1048593832 8:135845842-135845864 CCCTGTTACTGTGAGCATCTCTG No data
Right 1048593838 8:135845889-135845911 TCGATAATTAAGTGGTAGGATGG No data
1048593832_1048593839 28 Left 1048593832 8:135845842-135845864 CCCTGTTACTGTGAGCATCTCTG No data
Right 1048593839 8:135845893-135845915 TAATTAAGTGGTAGGATGGCTGG No data
1048593832_1048593836 16 Left 1048593832 8:135845842-135845864 CCCTGTTACTGTGAGCATCTCTG No data
Right 1048593836 8:135845881-135845903 AAAGAACATCGATAATTAAGTGG No data
1048593832_1048593837 20 Left 1048593832 8:135845842-135845864 CCCTGTTACTGTGAGCATCTCTG No data
Right 1048593837 8:135845885-135845907 AACATCGATAATTAAGTGGTAGG No data
1048593832_1048593840 29 Left 1048593832 8:135845842-135845864 CCCTGTTACTGTGAGCATCTCTG No data
Right 1048593840 8:135845894-135845916 AATTAAGTGGTAGGATGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048593832 Original CRISPR CAGAGATGCTCACAGTAACA GGG (reversed) Intergenic