ID: 1048593833

View in Genome Browser
Species Human (GRCh38)
Location 8:135845843-135845865
Sequence GCAGAGATGCTCACAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048593833_1048593836 15 Left 1048593833 8:135845843-135845865 CCTGTTACTGTGAGCATCTCTGC No data
Right 1048593836 8:135845881-135845903 AAAGAACATCGATAATTAAGTGG No data
1048593833_1048593840 28 Left 1048593833 8:135845843-135845865 CCTGTTACTGTGAGCATCTCTGC No data
Right 1048593840 8:135845894-135845916 AATTAAGTGGTAGGATGGCTGGG No data
1048593833_1048593837 19 Left 1048593833 8:135845843-135845865 CCTGTTACTGTGAGCATCTCTGC No data
Right 1048593837 8:135845885-135845907 AACATCGATAATTAAGTGGTAGG No data
1048593833_1048593839 27 Left 1048593833 8:135845843-135845865 CCTGTTACTGTGAGCATCTCTGC No data
Right 1048593839 8:135845893-135845915 TAATTAAGTGGTAGGATGGCTGG No data
1048593833_1048593838 23 Left 1048593833 8:135845843-135845865 CCTGTTACTGTGAGCATCTCTGC No data
Right 1048593838 8:135845889-135845911 TCGATAATTAAGTGGTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048593833 Original CRISPR GCAGAGATGCTCACAGTAAC AGG (reversed) Intergenic
No off target data available for this crispr