ID: 1048593834

View in Genome Browser
Species Human (GRCh38)
Location 8:135845855-135845877
Sequence AGCATCTCTGCTAGCCTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048593824_1048593834 28 Left 1048593824 8:135845804-135845826 CCACTTGAAAAAGATGAACCCTG No data
Right 1048593834 8:135845855-135845877 AGCATCTCTGCTAGCCTCATAGG No data
1048593831_1048593834 2 Left 1048593831 8:135845830-135845852 CCACAGGGGTGGCCCTGTTACTG No data
Right 1048593834 8:135845855-135845877 AGCATCTCTGCTAGCCTCATAGG No data
1048593830_1048593834 9 Left 1048593830 8:135845823-135845845 CCTGACTCCACAGGGGTGGCCCT No data
Right 1048593834 8:135845855-135845877 AGCATCTCTGCTAGCCTCATAGG No data
1048593829_1048593834 10 Left 1048593829 8:135845822-135845844 CCCTGACTCCACAGGGGTGGCCC No data
Right 1048593834 8:135845855-135845877 AGCATCTCTGCTAGCCTCATAGG No data
1048593832_1048593834 -10 Left 1048593832 8:135845842-135845864 CCCTGTTACTGTGAGCATCTCTG No data
Right 1048593834 8:135845855-135845877 AGCATCTCTGCTAGCCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048593834 Original CRISPR AGCATCTCTGCTAGCCTCAT AGG Intergenic