ID: 1048593835

View in Genome Browser
Species Human (GRCh38)
Location 8:135845869-135845891
Sequence CGATGTTCTTTTTGCCTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048593835_1048593842 10 Left 1048593835 8:135845869-135845891 CCTCATAGGCAAAAAGAACATCG No data
Right 1048593842 8:135845902-135845924 GGTAGGATGGCTGGGAGTGGCGG No data
1048593835_1048593837 -7 Left 1048593835 8:135845869-135845891 CCTCATAGGCAAAAAGAACATCG No data
Right 1048593837 8:135845885-135845907 AACATCGATAATTAAGTGGTAGG No data
1048593835_1048593839 1 Left 1048593835 8:135845869-135845891 CCTCATAGGCAAAAAGAACATCG No data
Right 1048593839 8:135845893-135845915 TAATTAAGTGGTAGGATGGCTGG No data
1048593835_1048593838 -3 Left 1048593835 8:135845869-135845891 CCTCATAGGCAAAAAGAACATCG No data
Right 1048593838 8:135845889-135845911 TCGATAATTAAGTGGTAGGATGG No data
1048593835_1048593840 2 Left 1048593835 8:135845869-135845891 CCTCATAGGCAAAAAGAACATCG No data
Right 1048593840 8:135845894-135845916 AATTAAGTGGTAGGATGGCTGGG No data
1048593835_1048593841 7 Left 1048593835 8:135845869-135845891 CCTCATAGGCAAAAAGAACATCG No data
Right 1048593841 8:135845899-135845921 AGTGGTAGGATGGCTGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048593835 Original CRISPR CGATGTTCTTTTTGCCTATG AGG (reversed) Intergenic
No off target data available for this crispr