ID: 1048593836

View in Genome Browser
Species Human (GRCh38)
Location 8:135845881-135845903
Sequence AAAGAACATCGATAATTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048593833_1048593836 15 Left 1048593833 8:135845843-135845865 CCTGTTACTGTGAGCATCTCTGC No data
Right 1048593836 8:135845881-135845903 AAAGAACATCGATAATTAAGTGG No data
1048593831_1048593836 28 Left 1048593831 8:135845830-135845852 CCACAGGGGTGGCCCTGTTACTG No data
Right 1048593836 8:135845881-135845903 AAAGAACATCGATAATTAAGTGG No data
1048593832_1048593836 16 Left 1048593832 8:135845842-135845864 CCCTGTTACTGTGAGCATCTCTG No data
Right 1048593836 8:135845881-135845903 AAAGAACATCGATAATTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048593836 Original CRISPR AAAGAACATCGATAATTAAG TGG Intergenic