ID: 1048593840

View in Genome Browser
Species Human (GRCh38)
Location 8:135845894-135845916
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048593835_1048593840 2 Left 1048593835 8:135845869-135845891 CCTCATAGGCAAAAAGAACATCG No data
Right 1048593840 8:135845894-135845916 AATTAAGTGGTAGGATGGCTGGG No data
1048593832_1048593840 29 Left 1048593832 8:135845842-135845864 CCCTGTTACTGTGAGCATCTCTG No data
Right 1048593840 8:135845894-135845916 AATTAAGTGGTAGGATGGCTGGG No data
1048593833_1048593840 28 Left 1048593833 8:135845843-135845865 CCTGTTACTGTGAGCATCTCTGC No data
Right 1048593840 8:135845894-135845916 AATTAAGTGGTAGGATGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048593840 Original CRISPR AATTAAGTGGTAGGATGGCT GGG Intergenic