ID: 1048593842 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:135845902-135845924 |
| Sequence | GGTAGGATGGCTGGGAGTGG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1048593835_1048593842 | 10 | Left | 1048593835 | 8:135845869-135845891 | CCTCATAGGCAAAAAGAACATCG | No data | ||
| Right | 1048593842 | 8:135845902-135845924 | GGTAGGATGGCTGGGAGTGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1048593842 | Original CRISPR | GGTAGGATGGCTGGGAGTGG CGG | Intergenic | ||