ID: 1048593842

View in Genome Browser
Species Human (GRCh38)
Location 8:135845902-135845924
Sequence GGTAGGATGGCTGGGAGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048593835_1048593842 10 Left 1048593835 8:135845869-135845891 CCTCATAGGCAAAAAGAACATCG No data
Right 1048593842 8:135845902-135845924 GGTAGGATGGCTGGGAGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048593842 Original CRISPR GGTAGGATGGCTGGGAGTGG CGG Intergenic
No off target data available for this crispr