ID: 1048596101 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:135868050-135868072 |
| Sequence | AGGAAGAAACAATATGATGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1048596101_1048596105 | 3 | Left | 1048596101 | 8:135868050-135868072 | CCAACATCATATTGTTTCTTCCT | No data | ||
| Right | 1048596105 | 8:135868076-135868098 | GATCTTGGCTCATCTTGCTTTGG | No data | ||||
| 1048596101_1048596107 | 30 | Left | 1048596101 | 8:135868050-135868072 | CCAACATCATATTGTTTCTTCCT | No data | ||
| Right | 1048596107 | 8:135868103-135868125 | CTTCCCATCCTTCAAACAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1048596101 | Original CRISPR | AGGAAGAAACAATATGATGT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||