ID: 1048596101

View in Genome Browser
Species Human (GRCh38)
Location 8:135868050-135868072
Sequence AGGAAGAAACAATATGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048596101_1048596105 3 Left 1048596101 8:135868050-135868072 CCAACATCATATTGTTTCTTCCT No data
Right 1048596105 8:135868076-135868098 GATCTTGGCTCATCTTGCTTTGG No data
1048596101_1048596107 30 Left 1048596101 8:135868050-135868072 CCAACATCATATTGTTTCTTCCT No data
Right 1048596107 8:135868103-135868125 CTTCCCATCCTTCAAACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048596101 Original CRISPR AGGAAGAAACAATATGATGT TGG (reversed) Intergenic
No off target data available for this crispr