ID: 1048598716

View in Genome Browser
Species Human (GRCh38)
Location 8:135895549-135895571
Sequence CATTCCAAGTAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048598716_1048598720 1 Left 1048598716 8:135895549-135895571 CCTTCCTCCTTCTACTTGGAATG No data
Right 1048598720 8:135895573-135895595 GCTCCCTTTCGCAGGTGTCCTGG No data
1048598716_1048598719 -7 Left 1048598716 8:135895549-135895571 CCTTCCTCCTTCTACTTGGAATG No data
Right 1048598719 8:135895565-135895587 TGGAATGTGCTCCCTTTCGCAGG No data
1048598716_1048598724 26 Left 1048598716 8:135895549-135895571 CCTTCCTCCTTCTACTTGGAATG No data
Right 1048598724 8:135895598-135895620 TCCATCCTGACAACTTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048598716 Original CRISPR CATTCCAAGTAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr