ID: 1048606438

View in Genome Browser
Species Human (GRCh38)
Location 8:135973483-135973505
Sequence ATCCCAGGGCAGCAAGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048606433_1048606438 4 Left 1048606433 8:135973456-135973478 CCTGTTAATGCTTTATTGGGACG No data
Right 1048606438 8:135973483-135973505 ATCCCAGGGCAGCAAGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048606438 Original CRISPR ATCCCAGGGCAGCAAGGGAA AGG Intergenic
No off target data available for this crispr