ID: 1048612842

View in Genome Browser
Species Human (GRCh38)
Location 8:136042453-136042475
Sequence CAGAATAATTTGATGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048612837_1048612842 30 Left 1048612837 8:136042400-136042422 CCTCTGTAAACAAAGTAATCGAT No data
Right 1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048612842 Original CRISPR CAGAATAATTTGATGGATTC TGG Intergenic
No off target data available for this crispr