ID: 1048621347

View in Genome Browser
Species Human (GRCh38)
Location 8:136136155-136136177
Sequence CTAGTTTATCAGGTTTGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048621347_1048621350 16 Left 1048621347 8:136136155-136136177 CCAATGCAAACCTGATAAACTAG No data
Right 1048621350 8:136136194-136136216 AATGTATGAACAATTTTAGACGG No data
1048621347_1048621351 21 Left 1048621347 8:136136155-136136177 CCAATGCAAACCTGATAAACTAG No data
Right 1048621351 8:136136199-136136221 ATGAACAATTTTAGACGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048621347 Original CRISPR CTAGTTTATCAGGTTTGCAT TGG (reversed) Intergenic
No off target data available for this crispr