ID: 1048622977

View in Genome Browser
Species Human (GRCh38)
Location 8:136154989-136155011
Sequence CCTCACCTCATGAAGTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048622977_1048622980 8 Left 1048622977 8:136154989-136155011 CCAAACTACTTCATGAGGTGAGG No data
Right 1048622980 8:136155020-136155042 CTCAATATGCTGTGAAAAGTGGG No data
1048622977_1048622979 7 Left 1048622977 8:136154989-136155011 CCAAACTACTTCATGAGGTGAGG No data
Right 1048622979 8:136155019-136155041 GCTCAATATGCTGTGAAAAGTGG No data
1048622977_1048622981 16 Left 1048622977 8:136154989-136155011 CCAAACTACTTCATGAGGTGAGG No data
Right 1048622981 8:136155028-136155050 GCTGTGAAAAGTGGGTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048622977 Original CRISPR CCTCACCTCATGAAGTAGTT TGG (reversed) Intergenic
No off target data available for this crispr