ID: 1048624112

View in Genome Browser
Species Human (GRCh38)
Location 8:136165938-136165960
Sequence ACACCTGGATTTCAGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 896
Summary {0: 1, 1: 1, 2: 17, 3: 93, 4: 784}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048624112_1048624116 1 Left 1048624112 8:136165938-136165960 CCACCAGGCTGAAATCCAGGTGT 0: 1
1: 1
2: 17
3: 93
4: 784
Right 1048624116 8:136165962-136165984 CACCAGGACTTTTCTTCACCTGG 0: 1
1: 0
2: 1
3: 11
4: 154
1048624112_1048624118 4 Left 1048624112 8:136165938-136165960 CCACCAGGCTGAAATCCAGGTGT 0: 1
1: 1
2: 17
3: 93
4: 784
Right 1048624118 8:136165965-136165987 CAGGACTTTTCTTCACCTGGAGG 0: 1
1: 0
2: 2
3: 15
4: 165
1048624112_1048624119 13 Left 1048624112 8:136165938-136165960 CCACCAGGCTGAAATCCAGGTGT 0: 1
1: 1
2: 17
3: 93
4: 784
Right 1048624119 8:136165974-136165996 TCTTCACCTGGAGGCCCAGCTGG 0: 1
1: 0
2: 5
3: 33
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048624112 Original CRISPR ACACCTGGATTTCAGCCTGG TGG (reversed) Intergenic