ID: 1048624542

View in Genome Browser
Species Human (GRCh38)
Location 8:136170887-136170909
Sequence TCTTAATTACTGCAGCTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048624541_1048624542 -2 Left 1048624541 8:136170866-136170888 CCATTTAGTAACACAACACAATC No data
Right 1048624542 8:136170887-136170909 TCTTAATTACTGCAGCTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048624542 Original CRISPR TCTTAATTACTGCAGCTATA TGG Intergenic
No off target data available for this crispr