ID: 1048626159

View in Genome Browser
Species Human (GRCh38)
Location 8:136187667-136187689
Sequence CTGTATCTGCAAAAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048626155_1048626159 3 Left 1048626155 8:136187641-136187663 CCAAAAAGAGAAGCAAGAAGCAC No data
Right 1048626159 8:136187667-136187689 CTGTATCTGCAAAAGGTGGCAGG No data
1048626154_1048626159 7 Left 1048626154 8:136187637-136187659 CCTTCCAAAAAGAGAAGCAAGAA No data
Right 1048626159 8:136187667-136187689 CTGTATCTGCAAAAGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048626159 Original CRISPR CTGTATCTGCAAAAGGTGGC AGG Intergenic
No off target data available for this crispr