ID: 1048628028

View in Genome Browser
Species Human (GRCh38)
Location 8:136208090-136208112
Sequence GAACAAAGAGTGTTAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048628028_1048628032 23 Left 1048628028 8:136208090-136208112 CCATTTTCTAACACTCTTTGTTC No data
Right 1048628032 8:136208136-136208158 TGTTTTTCTCAAGCCCAAAAGGG No data
1048628028_1048628031 22 Left 1048628028 8:136208090-136208112 CCATTTTCTAACACTCTTTGTTC No data
Right 1048628031 8:136208135-136208157 CTGTTTTTCTCAAGCCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048628028 Original CRISPR GAACAAAGAGTGTTAGAAAA TGG (reversed) Intergenic
No off target data available for this crispr