ID: 1048628031

View in Genome Browser
Species Human (GRCh38)
Location 8:136208135-136208157
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048628028_1048628031 22 Left 1048628028 8:136208090-136208112 CCATTTTCTAACACTCTTTGTTC No data
Right 1048628031 8:136208135-136208157 CTGTTTTTCTCAAGCCCAAAAGG No data
1048628029_1048628031 -10 Left 1048628029 8:136208122-136208144 CCCAAATGCTCATCTGTTTTTCT No data
Right 1048628031 8:136208135-136208157 CTGTTTTTCTCAAGCCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048628031 Original CRISPR CTGTTTTTCTCAAGCCCAAA AGG Intergenic
No off target data available for this crispr