ID: 1048630183

View in Genome Browser
Species Human (GRCh38)
Location 8:136233948-136233970
Sequence GAGAATAAGCAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048630183_1048630191 27 Left 1048630183 8:136233948-136233970 CCATCCTGCTTCTGCTTATTCTC No data
Right 1048630191 8:136233998-136234020 GTCTACCTCAGTTGGAAATGCGG No data
1048630183_1048630190 19 Left 1048630183 8:136233948-136233970 CCATCCTGCTTCTGCTTATTCTC No data
Right 1048630190 8:136233990-136234012 GACGAACAGTCTACCTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048630183 Original CRISPR GAGAATAAGCAGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr