ID: 1048631490

View in Genome Browser
Species Human (GRCh38)
Location 8:136247645-136247667
Sequence CAGCAAACAGCAGTGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048631490_1048631499 24 Left 1048631490 8:136247645-136247667 CCATTCACCACTGCTGTTTGCTG No data
Right 1048631499 8:136247692-136247714 CCACCCCTCTGGATCTGGCACGG 0: 10
1: 46
2: 99
3: 132
4: 299
1048631490_1048631497 19 Left 1048631490 8:136247645-136247667 CCATTCACCACTGCTGTTTGCTG No data
Right 1048631497 8:136247687-136247709 GACTTCCACCCCTCTGGATCTGG 0: 28
1: 72
2: 82
3: 94
4: 145
1048631490_1048631495 13 Left 1048631490 8:136247645-136247667 CCATTCACCACTGCTGTTTGCTG No data
Right 1048631495 8:136247681-136247703 TCCGCTGACTTCCACCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048631490 Original CRISPR CAGCAAACAGCAGTGGTGAA TGG (reversed) Intergenic
No off target data available for this crispr