ID: 1048631932

View in Genome Browser
Species Human (GRCh38)
Location 8:136252882-136252904
Sequence TTTGATTGGCAGAAGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048631929_1048631932 13 Left 1048631929 8:136252846-136252868 CCTTCTTTTAGTTAGCTGGTGGT No data
Right 1048631932 8:136252882-136252904 TTTGATTGGCAGAAGGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048631932 Original CRISPR TTTGATTGGCAGAAGGTGAA TGG Intergenic
No off target data available for this crispr