ID: 1048632483

View in Genome Browser
Species Human (GRCh38)
Location 8:136259191-136259213
Sequence GGCAACACCTAAACTAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048632483_1048632485 -7 Left 1048632483 8:136259191-136259213 CCAACACTAGTTTAGGTGTTGCC No data
Right 1048632485 8:136259207-136259229 TGTTGCCACACAGGTATTTCTGG No data
1048632483_1048632486 -3 Left 1048632483 8:136259191-136259213 CCAACACTAGTTTAGGTGTTGCC No data
Right 1048632486 8:136259211-136259233 GCCACACAGGTATTTCTGGATGG No data
1048632483_1048632488 -2 Left 1048632483 8:136259191-136259213 CCAACACTAGTTTAGGTGTTGCC No data
Right 1048632488 8:136259212-136259234 CCACACAGGTATTTCTGGATGGG No data
1048632483_1048632489 -1 Left 1048632483 8:136259191-136259213 CCAACACTAGTTTAGGTGTTGCC No data
Right 1048632489 8:136259213-136259235 CACACAGGTATTTCTGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048632483 Original CRISPR GGCAACACCTAAACTAGTGT TGG (reversed) Intergenic
No off target data available for this crispr