ID: 1048635470

View in Genome Browser
Species Human (GRCh38)
Location 8:136290764-136290786
Sequence CAGTAGTGGGAGGGGACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048635461_1048635470 -5 Left 1048635461 8:136290746-136290768 CCTAAAACCAGCTTGTGTCAGTA No data
Right 1048635470 8:136290764-136290786 CAGTAGTGGGAGGGGACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048635470 Original CRISPR CAGTAGTGGGAGGGGACCTG GGG Intergenic
No off target data available for this crispr