ID: 1048639059

View in Genome Browser
Species Human (GRCh38)
Location 8:136332552-136332574
Sequence CTGTGGTACCAAAAGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048639053_1048639059 18 Left 1048639053 8:136332511-136332533 CCTGGGTTTGTTTATCTATCCAT No data
Right 1048639059 8:136332552-136332574 CTGTGGTACCAAAAGGCAGGAGG No data
1048639055_1048639059 -1 Left 1048639055 8:136332530-136332552 CCATGCAGCATTGATGGAGAAAC No data
Right 1048639059 8:136332552-136332574 CTGTGGTACCAAAAGGCAGGAGG No data
1048639052_1048639059 19 Left 1048639052 8:136332510-136332532 CCCTGGGTTTGTTTATCTATCCA No data
Right 1048639059 8:136332552-136332574 CTGTGGTACCAAAAGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048639059 Original CRISPR CTGTGGTACCAAAAGGCAGG AGG Intergenic
No off target data available for this crispr