ID: 1048643048

View in Genome Browser
Species Human (GRCh38)
Location 8:136385979-136386001
Sequence CTGGACTAATAGGGAAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048643043_1048643048 10 Left 1048643043 8:136385946-136385968 CCTATCTCTGATTATTTGGGGAT No data
Right 1048643048 8:136385979-136386001 CTGGACTAATAGGGAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048643048 Original CRISPR CTGGACTAATAGGGAAAAAT GGG Intergenic
No off target data available for this crispr