ID: 1048643163

View in Genome Browser
Species Human (GRCh38)
Location 8:136387345-136387367
Sequence AAGGAGAAGCAGAGGGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048643163_1048643166 -9 Left 1048643163 8:136387345-136387367 CCATACTCCCTCTGCTTCTCCTT No data
Right 1048643166 8:136387359-136387381 CTTCTCCTTGTTTGTGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048643163 Original CRISPR AAGGAGAAGCAGAGGGAGTA TGG (reversed) Intergenic
No off target data available for this crispr