ID: 1048643800

View in Genome Browser
Species Human (GRCh38)
Location 8:136394913-136394935
Sequence CTGTTTCAGTGGGATGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048643793_1048643800 -8 Left 1048643793 8:136394898-136394920 CCACTCCCAGAGTTTCTGTTTCA No data
Right 1048643800 8:136394913-136394935 CTGTTTCAGTGGGATGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048643800 Original CRISPR CTGTTTCAGTGGGATGTGGG TGG Intergenic
No off target data available for this crispr