ID: 1048645482

View in Genome Browser
Species Human (GRCh38)
Location 8:136414741-136414763
Sequence CAGCCCGCATCCCAGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048645482_1048645487 8 Left 1048645482 8:136414741-136414763 CCCAGTGCCTGGGATGCGGGCTG No data
Right 1048645487 8:136414772-136414794 AGAAGAGACAGCACAGGTATAGG No data
1048645482_1048645490 20 Left 1048645482 8:136414741-136414763 CCCAGTGCCTGGGATGCGGGCTG No data
Right 1048645490 8:136414784-136414806 ACAGGTATAGGTAGGCATCAGGG No data
1048645482_1048645485 2 Left 1048645482 8:136414741-136414763 CCCAGTGCCTGGGATGCGGGCTG No data
Right 1048645485 8:136414766-136414788 TGCTCCAGAAGAGACAGCACAGG No data
1048645482_1048645488 12 Left 1048645482 8:136414741-136414763 CCCAGTGCCTGGGATGCGGGCTG No data
Right 1048645488 8:136414776-136414798 GAGACAGCACAGGTATAGGTAGG No data
1048645482_1048645489 19 Left 1048645482 8:136414741-136414763 CCCAGTGCCTGGGATGCGGGCTG No data
Right 1048645489 8:136414783-136414805 CACAGGTATAGGTAGGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048645482 Original CRISPR CAGCCCGCATCCCAGGCACT GGG (reversed) Intergenic
No off target data available for this crispr