ID: 1048646031

View in Genome Browser
Species Human (GRCh38)
Location 8:136420750-136420772
Sequence GTTAGAAGCGTGGACATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048646031_1048646034 16 Left 1048646031 8:136420750-136420772 CCACAAATGTCCACGCTTCTAAC No data
Right 1048646034 8:136420789-136420811 ATACTAACTGTAAACACCGAGGG No data
1048646031_1048646033 15 Left 1048646031 8:136420750-136420772 CCACAAATGTCCACGCTTCTAAC No data
Right 1048646033 8:136420788-136420810 AATACTAACTGTAAACACCGAGG No data
1048646031_1048646035 23 Left 1048646031 8:136420750-136420772 CCACAAATGTCCACGCTTCTAAC No data
Right 1048646035 8:136420796-136420818 CTGTAAACACCGAGGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048646031 Original CRISPR GTTAGAAGCGTGGACATTTG TGG (reversed) Intergenic
No off target data available for this crispr