ID: 1048646033

View in Genome Browser
Species Human (GRCh38)
Location 8:136420788-136420810
Sequence AATACTAACTGTAAACACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048646032_1048646033 5 Left 1048646032 8:136420760-136420782 CCACGCTTCTAACTCTTTAAAGA No data
Right 1048646033 8:136420788-136420810 AATACTAACTGTAAACACCGAGG No data
1048646031_1048646033 15 Left 1048646031 8:136420750-136420772 CCACAAATGTCCACGCTTCTAAC No data
Right 1048646033 8:136420788-136420810 AATACTAACTGTAAACACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048646033 Original CRISPR AATACTAACTGTAAACACCG AGG Intergenic
No off target data available for this crispr