ID: 1048646034

View in Genome Browser
Species Human (GRCh38)
Location 8:136420789-136420811
Sequence ATACTAACTGTAAACACCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048646032_1048646034 6 Left 1048646032 8:136420760-136420782 CCACGCTTCTAACTCTTTAAAGA No data
Right 1048646034 8:136420789-136420811 ATACTAACTGTAAACACCGAGGG No data
1048646031_1048646034 16 Left 1048646031 8:136420750-136420772 CCACAAATGTCCACGCTTCTAAC No data
Right 1048646034 8:136420789-136420811 ATACTAACTGTAAACACCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048646034 Original CRISPR ATACTAACTGTAAACACCGA GGG Intergenic
No off target data available for this crispr