ID: 1048646034 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:136420789-136420811 |
Sequence | ATACTAACTGTAAACACCGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1048646032_1048646034 | 6 | Left | 1048646032 | 8:136420760-136420782 | CCACGCTTCTAACTCTTTAAAGA | No data | ||
Right | 1048646034 | 8:136420789-136420811 | ATACTAACTGTAAACACCGAGGG | No data | ||||
1048646031_1048646034 | 16 | Left | 1048646031 | 8:136420750-136420772 | CCACAAATGTCCACGCTTCTAAC | No data | ||
Right | 1048646034 | 8:136420789-136420811 | ATACTAACTGTAAACACCGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1048646034 | Original CRISPR | ATACTAACTGTAAACACCGA GGG | Intergenic | ||
No off target data available for this crispr |