ID: 1048646035

View in Genome Browser
Species Human (GRCh38)
Location 8:136420796-136420818
Sequence CTGTAAACACCGAGGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048646031_1048646035 23 Left 1048646031 8:136420750-136420772 CCACAAATGTCCACGCTTCTAAC No data
Right 1048646035 8:136420796-136420818 CTGTAAACACCGAGGGAGAATGG No data
1048646032_1048646035 13 Left 1048646032 8:136420760-136420782 CCACGCTTCTAACTCTTTAAAGA No data
Right 1048646035 8:136420796-136420818 CTGTAAACACCGAGGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048646035 Original CRISPR CTGTAAACACCGAGGGAGAA TGG Intergenic
No off target data available for this crispr