ID: 1048648577

View in Genome Browser
Species Human (GRCh38)
Location 8:136449699-136449721
Sequence CCTCTCCCTAGAAGACCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048648577_1048648584 19 Left 1048648577 8:136449699-136449721 CCCACGGGTCTTCTAGGGAGAGG No data
Right 1048648584 8:136449741-136449763 CTTGGTTACAAGTGAGGACAGGG No data
1048648577_1048648582 13 Left 1048648577 8:136449699-136449721 CCCACGGGTCTTCTAGGGAGAGG No data
Right 1048648582 8:136449735-136449757 TACTGACTTGGTTACAAGTGAGG No data
1048648577_1048648585 20 Left 1048648577 8:136449699-136449721 CCCACGGGTCTTCTAGGGAGAGG No data
Right 1048648585 8:136449742-136449764 TTGGTTACAAGTGAGGACAGGGG No data
1048648577_1048648581 1 Left 1048648577 8:136449699-136449721 CCCACGGGTCTTCTAGGGAGAGG No data
Right 1048648581 8:136449723-136449745 ACGAGCTTTGAATACTGACTTGG No data
1048648577_1048648583 18 Left 1048648577 8:136449699-136449721 CCCACGGGTCTTCTAGGGAGAGG No data
Right 1048648583 8:136449740-136449762 ACTTGGTTACAAGTGAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048648577 Original CRISPR CCTCTCCCTAGAAGACCCGT GGG (reversed) Intergenic
No off target data available for this crispr