ID: 1048655569

View in Genome Browser
Species Human (GRCh38)
Location 8:136531846-136531868
Sequence TCCAGTGTATTGAAGGCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048655569_1048655573 9 Left 1048655569 8:136531846-136531868 CCTATTGCCTTCAATACACTGGA No data
Right 1048655573 8:136531878-136531900 CATTTTGCATAAAGTCCCGGAGG No data
1048655569_1048655572 6 Left 1048655569 8:136531846-136531868 CCTATTGCCTTCAATACACTGGA No data
Right 1048655572 8:136531875-136531897 TTACATTTTGCATAAAGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048655569 Original CRISPR TCCAGTGTATTGAAGGCAAT AGG (reversed) Intergenic
No off target data available for this crispr