ID: 1048655578

View in Genome Browser
Species Human (GRCh38)
Location 8:136531936-136531958
Sequence GTCCTGTGGCAAGACTGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048655575_1048655578 19 Left 1048655575 8:136531894-136531916 CCGGAGGACTGCATTATGATAGA No data
Right 1048655578 8:136531936-136531958 GTCCTGTGGCAAGACTGTTAAGG No data
1048655574_1048655578 20 Left 1048655574 8:136531893-136531915 CCCGGAGGACTGCATTATGATAG No data
Right 1048655578 8:136531936-136531958 GTCCTGTGGCAAGACTGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048655578 Original CRISPR GTCCTGTGGCAAGACTGTTA AGG Intergenic
No off target data available for this crispr