ID: 1048668716

View in Genome Browser
Species Human (GRCh38)
Location 8:136693432-136693454
Sequence AGGATGTACTTGAGGATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048668716_1048668721 0 Left 1048668716 8:136693432-136693454 CCCTCTATCCTCAAGTACATCCT No data
Right 1048668721 8:136693455-136693477 GGTGTCCATTATTCCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048668716 Original CRISPR AGGATGTACTTGAGGATAGA GGG (reversed) Intergenic
No off target data available for this crispr