ID: 1048668717

View in Genome Browser
Species Human (GRCh38)
Location 8:136693433-136693455
Sequence CAGGATGTACTTGAGGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048668717_1048668721 -1 Left 1048668717 8:136693433-136693455 CCTCTATCCTCAAGTACATCCTG No data
Right 1048668721 8:136693455-136693477 GGTGTCCATTATTCCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048668717 Original CRISPR CAGGATGTACTTGAGGATAG AGG (reversed) Intergenic
No off target data available for this crispr