ID: 1048668721

View in Genome Browser
Species Human (GRCh38)
Location 8:136693455-136693477
Sequence GGTGTCCATTATTCCCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048668719_1048668721 -8 Left 1048668719 8:136693440-136693462 CCTCAAGTACATCCTGGTGTCCA No data
Right 1048668721 8:136693455-136693477 GGTGTCCATTATTCCCCTCTTGG No data
1048668716_1048668721 0 Left 1048668716 8:136693432-136693454 CCCTCTATCCTCAAGTACATCCT No data
Right 1048668721 8:136693455-136693477 GGTGTCCATTATTCCCCTCTTGG No data
1048668714_1048668721 10 Left 1048668714 8:136693422-136693444 CCTCCTCTGACCCTCTATCCTCA No data
Right 1048668721 8:136693455-136693477 GGTGTCCATTATTCCCCTCTTGG No data
1048668712_1048668721 16 Left 1048668712 8:136693416-136693438 CCTCACCCTCCTCTGACCCTCTA No data
Right 1048668721 8:136693455-136693477 GGTGTCCATTATTCCCCTCTTGG No data
1048668713_1048668721 11 Left 1048668713 8:136693421-136693443 CCCTCCTCTGACCCTCTATCCTC No data
Right 1048668721 8:136693455-136693477 GGTGTCCATTATTCCCCTCTTGG No data
1048668717_1048668721 -1 Left 1048668717 8:136693433-136693455 CCTCTATCCTCAAGTACATCCTG No data
Right 1048668721 8:136693455-136693477 GGTGTCCATTATTCCCCTCTTGG No data
1048668715_1048668721 7 Left 1048668715 8:136693425-136693447 CCTCTGACCCTCTATCCTCAAGT No data
Right 1048668721 8:136693455-136693477 GGTGTCCATTATTCCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048668721 Original CRISPR GGTGTCCATTATTCCCCTCT TGG Intergenic
No off target data available for this crispr